6w3n

X-ray diffraction
2.69Å resolution

APE1 exonuclease substrate complex D148E

Released:

Function and Biology Details

Reaction catalysed:
Exonucleolytic cleavage in the 3'- to 5'-direction to yield nucleoside 5'-phosphates
Biochemical function:
Biological process:
Cellular component:
  • not assigned

Structure analysis Details

Assemblies composition:
hetero tetramer (preferred)
monomeric
PDBe Complex ID:
PDB-CPX-120800 (preferred)
Entry contents:
1 distinct polypeptide molecule
3 distinct DNA molecules
Macromolecules (4 distinct):
DNA repair nuclease/redox regulator APEX1, mitochondrial Chains: A, B
Molecule details ›
Chains: A, B
Length: 276 amino acids
Theoretical weight: 31.2 KDa
Source organism: Homo sapiens
Expression system: Escherichia coli
UniProt:
  • Canonical: P27695 (Residues: 43-318; Coverage: 87%)
Gene names: APE, APE1, APEX, APEX1, APX, HAP1, REF1
Sequence domains: Endonuclease/Exonuclease/phosphatase family
TCGACGGATCC Chain: C
Molecule details ›
Chain: C
Length: 11 nucleotides
Theoretical weight: 3.33 KDa
Source organism: synthetic construct
Expression system: Not provided
DNA (5'-D(*GP*CP*TP*GP*AP*TP*GP*CP*GP*(C7R))-3') Chain: D
Molecule details ›
Chain: D
Length: 10 nucleotides
Theoretical weight: 3.08 KDa
Source organism: synthetic construct
Expression system: Not provided
GGATCCGTCGATCGCATCAGC Chain: E
Molecule details ›
Chain: E
Length: 21 nucleotides
Theoretical weight: 6.42 KDa
Source organism: synthetic construct
Expression system: Not provided

Ligands and Environments

2 bound ligands:
1 modified residue:

Experiments and Validation Details

Entry percentile scores
X-ray source: RIGAKU MICROMAX-007
Spacegroup: P21
Unit cell:
a: 71.554Å b: 65.074Å c: 91.424Å
α: 90° β: 109.928° γ: 90°
R-values:
R R work R free
0.255 0.249 0.308
Expression systems:
  • Escherichia coli
  • Not provided