1kx3

X-ray diffraction
2Å resolution

X-Ray Structure of the Nucleosome Core Particle, NCP146, at 2.0 A Resolution

Released:

Function and Biology Details

Structure analysis Details

Assembly composition:
hetero decamer (preferred)
PDBe Complex ID:
PDB-CPX-114098 (preferred)
Entry contents:
4 distinct polypeptide molecules
1 distinct DNA molecule
Macromolecules (5 distinct):
Histone H3.2 Chains: A, E
Molecule details ›
Chains: A, E
Length: 135 amino acids
Theoretical weight: 15.3 KDa
Source organism: Xenopus laevis
Expression system: Escherichia coli
UniProt:
  • Canonical: P84233 (Residues: 2-136; Coverage: 99%)
Sequence domains: Core histone H2A/H2B/H3/H4
Structure domains: Histone, subunit A
Histone H4 Chains: B, F
Molecule details ›
Chains: B, F
Length: 102 amino acids
Theoretical weight: 11.26 KDa
Source organism: Xenopus laevis
Expression system: Escherichia coli
UniProt:
  • Canonical: P62799 (Residues: 2-103; Coverage: 99%)
Sequence domains: Centromere kinetochore component CENP-T histone fold
Structure domains: Histone, subunit A
Histone H2A type 1 Chains: C, G
Molecule details ›
Chains: C, G
Length: 128 amino acids
Theoretical weight: 13.91 KDa
Source organism: Xenopus laevis
Expression system: Escherichia coli
UniProt:
  • Canonical: P06897 (Residues: 2-130; Coverage: 99%)
Sequence domains:
Structure domains: Histone, subunit A
Histone H2B 1.1 Chains: D, H
Molecule details ›
Chains: D, H
Length: 125 amino acids
Theoretical weight: 13.85 KDa
Source organism: Xenopus laevis
Expression system: Escherichia coli
UniProt:
  • Canonical: P02281 (Residues: 2-126; Coverage: 99%)
Sequence domains: Core histone H2A/H2B/H3/H4
Structure domains: Histone, subunit A
DNA (5'(ATCAATATCCACCTGCAGATTCTACCAAAAGTGTATTTGGAAACTGCTCCATCAAAAGGCATGTTCAGCTGAATTCAGCTGAACATGCCTTTTGATGGAGCAGTTTCCAAATACACTTTTGGTAGAATCTGCAGGTGGATATTGAT)3') Chains: I, J
Molecule details ›
Chains: I, J
Length: 146 nucleotides
Theoretical weight: 45.05 KDa

Ligands and Environments

1 bound ligand:
No modified residues

Experiments and Validation Details

Entry percentile scores
X-ray source: ESRF BEAMLINE ID09
Spacegroup: P212121
Unit cell:
a: 105.4Å b: 181.54Å c: 109.6Å
α: 90° β: 90° γ: 90°
R-values:
R R work R free
0.241 0.24 0.275
Expression system: Escherichia coli