› 1kx5

X-ray diffraction
1.94Å resolution

X-Ray Structure of the Nucleosome Core Particle, NCP147, at 1.9 A Resolution

Released:
DOI: 10.2210/pdb1kx5/pdb
PDB entry 1kx5 coloured by chain, front view.
PDB entry 1kx5 coloured by chain, side view.
PDB entry 1kx5 coloured by chain, top view.
Source organism: Xenopus laevis
Primary publication:
Solvent mediated interactions in the structure of the nucleosome core particle at 1.9 a resolution.
Davey CA, Sargent DF, Luger K, Maeder AW, Richmond TJ
J Mol Biol 319 1097-113 (2002)
PMID: 12079350

Function and Biology Details

Biochemical function:
Biological process:
Cellular component:
Sequence domains:
Structure domain:

Structure analysis Details

Assembly composition:
hetero decamer (preferred)
Assembly name:
PDBe Complex ID:
PDB-CPX-114100 (preferred)
Entry contents:
4 distinct polypeptide molecules
2 distinct DNA molecules
Macromolecules (6 distinct):
Histone H3.2 Chains: A, E
Molecule details ›
Chains: A, E
Length: 135 amino acids
Theoretical weight: 15.3 KDa
Source organism: Xenopus laevis
Expression system: Escherichia coli
UniProt:
  • Canonical: P84233 (Residues: 2-136; Coverage: 99%)
Sequence domains: Core histone H2A/H2B/H3/H4
Structure domains: Histone, subunit A
Histone H4 Chains: B, F
Molecule details ›
Chains: B, F
Length: 102 amino acids
Theoretical weight: 11.26 KDa
Source organism: Xenopus laevis
Expression system: Escherichia coli
UniProt:
  • Canonical: P62799 (Residues: 2-103; Coverage: 99%)
Sequence domains: Centromere kinetochore component CENP-T histone fold
Structure domains: Histone, subunit A
Histone H2A type 1 Chains: C, G
Molecule details ›
Chains: C, G
Length: 128 amino acids
Theoretical weight: 13.91 KDa
Source organism: Xenopus laevis
Expression system: Escherichia coli
UniProt:
  • Canonical: P06897 (Residues: 2-130; Coverage: 99%)
Sequence domains:
Structure domains: Histone, subunit A
Histone H2B 1.1 Chains: D, H
Molecule details ›
Chains: D, H
Length: 125 amino acids
Theoretical weight: 13.85 KDa
Source organism: Xenopus laevis
Expression system: Escherichia coli
UniProt:
  • Canonical: P02281 (Residues: 2-126; Coverage: 99%)
Sequence domains: Core histone H2A/H2B/H3/H4
Structure domains: Histone, subunit A
DNA (5'(ATCAATATCCACCTGCAGATACTACCAAAAGTGTATTTGGAAACTGCTCCATCAAAAGGCATGTTCAGCTGGAATCCAGCTGAACATGCCTTTTGATGGAGCAGTTTCCAAATACACTTTTGGTAGTATCTGCAGGTGGATATTGAT)3') Chain: I
Molecule details ›
Chain: I
Length: 147 nucleotides
Theoretical weight: 45.37 KDa
DNA (5'(ATCAATATCCACCTGCAGATACTACCAAAAGTGTATTTGGAAACTGCTCCATCAAAAGGCATGTTCAGCTGGATTCCAGCTGAACATGCCTTTTGATGGAGCAGTTTCCAAATACACTTTTGGTAGTATCTGCAGGTGGATATTGAT)3') Chain: J
Molecule details ›
Chain: J
Length: 147 nucleotides
Theoretical weight: 45.36 KDa

Ligands and Environments

2 bound ligands:
Ligand MN 14 x MN
Ligand CL 4 x CL
No modified residues

Experiments and Validation Details

Entry percentile scores
X-ray source: ESRF BEAMLINE ID14-4
Spacegroup: P212121
Unit cell:
a: 105.95Å b: 181.17Å c: 109.49Å
α: 90° β: 90° γ: 90°
R-values:
R R work R free
0.209 0.208 0.275
Expression system: Escherichia coli

Quick links

Citations

174 review citations

Nucleosome positioning and gene regulation: advances through genomics.
Jiang et al. (2009)
173 more

451 mentions without citation

Absence of a simple code: how transcription factors read the genome.
Slattery et al. (2014)
450 more