1qwb

Solution NMR

NMR structure of 5'-r(GGACACGAAAUCCCGAAGUAGUGUCC)-3' : an RNA hairpin containing the in vitro selected consensus sequence for nucleolin RBD12

Released:

Function and Biology Details

Biochemical function:
  • not assigned
Biological process:
  • not assigned
Cellular component:
  • not assigned

Structure analysis Details

Assembly composition:
monomeric (preferred)
Assembly name:
PDBe Complex ID:
PDB-CPX-196181 (preferred)
Entry contents:
1 distinct RNA molecule
Macromolecule:
sNRE26 Chain: A
Molecule details ›
Chain: A
Length: 26 nucleotides
Theoretical weight: 8.37 KDa
Source organism: Synthetic construct
Expression system: Not provided

Ligands and Environments

No bound ligands
No modified residues

Experiments and Validation Details

wwPDB Validation report is not available for this NMR entry.
Refinement method: simulated annealing
Expression system: Not provided