› 2m92

Solution NMR

Structure of d[AGGGTGGGTGCTGGGGCGCGAAGCATTCGCGAGG] quadruplex-duplex hybrid

Released:
DOI: 10.2210/pdb2m92/pdb
PDB entry 2m92 coloured by chain, ensemble of 10 models, front view.
PDB entry 2m92 coloured by chain, ensemble of 10 models, side view.
PDB entry 2m92 coloured by chain, ensemble of 10 models, top view.
Source organism: Synthetic construct
Primary publication:
Structural basis of DNA quadruplex-duplex junction formation.
Lim KW, Phan AT
Angew Chem Int Ed Engl 52 8566-9 (2013)
PMID: 23794476

Function and Biology Details

Biochemical function:
  • not assigned
Biological process:
  • not assigned
Cellular component:
  • not assigned

Structure analysis Details

Assembly composition:
monomeric (preferred)
Assembly name:
PDBe Complex ID:
PDB-CPX-115598 (preferred)
Entry contents:
1 distinct DNA molecule
Macromolecule:
34-MER DNA Chain: A
Molecule details ›
Chain: A
Length: 34 nucleotides
Theoretical weight: 10.7 KDa
Source organism: Synthetic construct
Expression system: Not provided

Ligands and Environments

No bound ligands
No modified residues

Experiments and Validation Details

Entry percentile scores
Chemical shift assignment: 36%
Refinement method: DGSA-distance geometry simulated annealing, Distance-restrained molecular dynamics
Expression system: Not provided

Quick links

Citations

4 review citations

Ligand Design to Acquire Specificity to Intended G-Quadruplex Structures.
Asamitsu et al. (2019)
3 more

2 mentions without citation

Three-dimensional modeling of single stranded DNA hairpins for aptamer-based biosensors.
Jeddi et al. (2017)
1 more