4ihv

X-ray diffraction
2.72Å resolution

Crystal structure of Fis bound to 27 bp sequence DNA F28 (AAATTTGTTTGAGCGTTGAGCAAATTT)

Released:

Function and Biology Details

Structure analysis Details

Assembly composition:
hetero tetramer (preferred)
PDBe Complex ID:
PDB-CPX-117644 (preferred)
Entry contents:
1 distinct polypeptide molecule
2 distinct DNA molecules
Macromolecules (3 distinct):
DNA-binding protein fis Chains: A, B
Molecule details ›
Chains: A, B
Length: 98 amino acids
Theoretical weight: 11.25 KDa
Source organism: Escherichia coli K-12
Expression system: Escherichia coli BL21(DE3)
Structure domains: Homeodomain-like
27-bp DNA Strand A Chain: C
Molecule details ›
Chain: C
Length: 27 nucleotides
Theoretical weight: 8.36 KDa
Source organism: Escherichia coli K-12
Expression system: Not provided
27-bp DNA Strand B Chain: D
Molecule details ›
Chain: D
Length: 27 nucleotides
Theoretical weight: 8.23 KDa
Source organism: Escherichia coli K-12
Expression system: Not provided

Ligands and Environments

No bound ligands
No modified residues

Experiments and Validation Details

Entry percentile scores
X-ray source: APS BEAMLINE 24-ID-C
Spacegroup: P212121
Unit cell:
a: 42.79Å b: 89.39Å c: 154.15Å
α: 90° β: 90° γ: 90°
R-values:
R R work R free
0.221 0.217 0.258
Expression systems:
  • Escherichia coli BL21(DE3)
  • Not provided