5e3m

X-ray diffraction
2.89Å resolution

Crystal structure of Fis bound to 27bp DNA F35 (AAATTAGTTTGAATCTCGAGCTAATTT)

Released:

Function and Biology Details

Structure analysis Details

Assembly composition:
hetero tetramer (preferred)
PDBe Complex ID:
PDB-CPX-118607 (preferred)
Entry contents:
1 distinct polypeptide molecule
2 distinct DNA molecules
Macromolecules (3 distinct):
DNA-binding protein Fis Chains: A, B
Molecule details ›
Chains: A, B
Length: 98 amino acids
Theoretical weight: 11.25 KDa
Source organism: Escherichia coli K-12
Expression system: Escherichia coli BL21(DE3)
UniProt:
  • Canonical: P0A6R3 (Residues: 1-98; Coverage: 100%)
Gene names: JW3229, b3261, fis
Sequence domains: Bacterial regulatory protein, Fis family
Structure domains: Homeodomain-like
DNA (27-MER) Chain: C
Molecule details ›
Chain: C
Length: 27 nucleotides
Theoretical weight: 8.3 KDa
Source organism: synthetic construct
Expression system: Not provided
DNA (27-MER) Chain: D
Molecule details ›
Chain: D
Length: 27 nucleotides
Theoretical weight: 8.28 KDa
Source organism: synthetic construct
Expression system: Not provided

Ligands and Environments

No bound ligands
No modified residues

Experiments and Validation Details

Entry percentile scores
X-ray source: ALS BEAMLINE 8.2.2
Spacegroup: C2
Unit cell:
a: 161.88Å b: 43.22Å c: 97.16Å
α: 90° β: 111.52° γ: 90°
R-values:
R R work R free
0.182 0.18 0.226
Expression systems:
  • Escherichia coli BL21(DE3)
  • Not provided