5e3n

X-ray diffraction
2.66Å resolution

Crystal structure of Fis bound to 27bp DNA F31 (AAATTTGTAGGAATTTTCTGCAAATTT)

Released:
Model geometry
Fit model/data

Function and Biology Details

Structure analysis Details

Assembly composition:
hetero tetramer (preferred)
PDBe Complex ID:
PDB-CPX-118608 (preferred)
Entry contents:
1 distinct polypeptide molecule
2 distinct DNA molecules
Macromolecules (3 distinct):
DNA-binding protein Fis Chains: A, B
Molecule details ›
Chains: A, B
Length: 98 amino acids
Theoretical weight: 11.25 KDa
Source organism: Escherichia coli K-12
Expression system: Escherichia coli BL21(DE3)
UniProt:
  • Canonical: P0A6R3 (Residues: 1-98; Coverage: 100%)
Gene names: JW3229, b3261, fis
Sequence domains: Bacterial regulatory protein, Fis family
Structure domains: Homeodomain-like
DNA (27-MER) Chain: C
Molecule details ›
Chain: C
Length: 27 nucleotides
Theoretical weight: 8.32 KDa
Source organism: synthetic construct
Expression system: Not provided
DNA (27-MER) Chain: D

Ligands and Environments

No bound ligands
No modified residues

Experiments and Validation Details

wwPDB Validation report is not available for this entry.
X-ray source: APS BEAMLINE 24-ID-C
Spacegroup: P212121
Unit cell:
a: 43.19Å b: 92.98Å c: 153.94Å
α: 90° β: 90° γ: 90°
R-values:
R R work R free
0.218 0.217 0.252
Expression systems:
  • Escherichia coli BL21(DE3)
  • Not provided