› 6w3l

X-ray diffraction
2.59Å resolution

APE1 exonuclease substrate complex wild-type

Released:
DOI: 10.2210/pdb6w3l/pdb
PDB entry 6w3l coloured by chain, front view.
PDB entry 6w3l coloured by chain, side view.
PDB entry 6w3l coloured by chain, top view.
Source organisms:
Primary publication:
Molecular and structural characterization of disease-associated APE1 polymorphisms.
Whitaker AM, Stark WJ, Flynn TS, Freudenthal BD
DNA Repair (Amst) 91-92 102867
PMID: 32454397

Function and Biology Details

Reaction catalysed: 
Exonucleolytic cleavage in the 3'- to 5'-direction to yield nucleoside 5'-phosphates
Biochemical function:
Biological process:
Cellular component:
  • not assigned
Sequence domains:

Structure analysis Details

Assemblies composition:
hetero tetramer (preferred)
monomeric
Assembly name:
PDBe Complex ID:
PDB-CPX-120799 (preferred)
Entry contents:
1 distinct polypeptide molecule
3 distinct DNA molecules
Macromolecules (4 distinct):
DNA repair nuclease/redox regulator APEX1, mitochondrial Chains: A, B
Molecule details ›
Chains: A, B
Length: 276 amino acids
Theoretical weight: 31.19 KDa
Source organism: Homo sapiens
Expression system: Escherichia coli
UniProt:
  • Canonical: P27695 (Residues: 43-318; Coverage: 87%)
Gene names: APE, APE1, APEX, APEX1, APX, HAP1, REF1
Sequence domains: Endonuclease/Exonuclease/phosphatase family
TCGACGGATCC Chain: C
Molecule details ›
Chain: C
Length: 11 nucleotides
Theoretical weight: 3.33 KDa
Source organism: synthetic construct
Expression system: Not provided
GCTGATGCG(C7R) Chain: D
Molecule details ›
Chain: D
Length: 10 nucleotides
Theoretical weight: 3.08 KDa
Source organism: synthetic construct
Expression system: Not provided
GGATCCGTCGATCGCATCAGC Chain: E
Molecule details ›
Chain: E
Length: 21 nucleotides
Theoretical weight: 6.42 KDa
Source organism: synthetic construct
Expression system: Not provided

Ligands and Environments

3 bound ligands:
Ligand CA 1 x CA
Ligand NA 2 x NA
Ligand EDO 1 x EDO
1 modified residue:
Ligand C7R 1 x C7R

Experiments and Validation Details

Entry percentile scores
X-ray source: RIGAKU MICROMAX-007
Spacegroup: P21
Unit cell:
a: 71.371Å b: 65.196Å c: 91.258Å
α: 90° β: 110.267° γ: 90°
R-values:
R R work R free
0.222 0.217 0.277
Expression systems:
  • Escherichia coli
  • Not provided

Quick links

Citations

5 review citations

APE1/Ref-1 Role in Inflammation and Immune Response.
Oliveira et al. (2022)
4 more

1 mention without citation

Molecular and structural characterization of disease-associated APE1 polymorphisms.
Whitaker et al. (2020)